bcrC [2019-07-15 07:56:51]

undecaprenyl pyrophosphate phosphatase, produces the carrier lipid for cell wall synthesis, secondary bacitracin resistance determinant

Locus: BSU_36530

Isoelectric point: 9.45

Molecular weight: 21.58 kDa

Protein length: 193 aa

Gene length: 582 bp

Function: cell wall synthesis, resistance to bacitracin and oxidative stress

Product: undecaprenyl pyrophosphate phosphatase

Essential: no

E.C.: 3.6.1.27

Synonyms: ywoA

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of the carrier lipid undecaprenylphosphate
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of the carrier lipid undecaprenylphosphate
• Lifestyles → Coping with stress → Resistance against toxins/ antibiotics/ based on similarity
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Lifestyles → Coping with stress → Heat shock proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,758,547 3,759,128

Phenotypes of a mutant

• 5-fold increased sensitivity to bacitracin PubMed
• reduced growth rate PubMed
• increased susceptibility to rare earth elements PubMed
• a bcrC uppP double mutant is not viable (unless pgpB is artificially expressed) PubMed

The protein

Catalyzed reaction/ biological activity

• undecaprenyl pyrophosphate - undecaprenyl phosphate

Protein family

• bcrC/ybjG/ywoA family (according to Swiss-Prot)

Effectors of protein activity

• inhibited by heptaprenyl pyrophosphate which accumulates in a ytpB mutant PubMed

Localization

• cell membrane (according to Swiss-Prot)

Additional information

• there is a second undecaprenyl pyrophosphate phosphatase in B. subtilis, UppP. However, UppP seems to play only a minor role. PubMed

Expression and Regulation

Operons

• Genes: bcrC

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigI: sigma factor, PubMed, in SigI regulon
  • SigW: sigma factor, PubMed, in SigW regulon
  • SigX: sigma factor, PubMed, in SigX regulon
  • SigV: sigma factor, in SigV regulon

  Regulation

  • expression activated by glucose (3.3 fold) PubMed
  • expression is induced by bacitracin PubMed

Biological materials

Mutant

• MGNA-A214 (ywoA::erm), available at the NBRP B. subtilis, Japan
• BKE36530 (bcrC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATAATCACCTTTTACAT, downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC
• BKK36530 (bcrC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATAATCACCTTTTACAT, downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC

References

Reviews

Loading

Original publications

Loading